![]() |
RulesEach player starts with a DNA sequence of 36 randomly generated nucleotides labelled A, C, G and T for adenine, guanine, cytosie and thymine respectively. Players take turns nominating a chunk of three consecutive nucleotides contained in their sequence. All instances of that chunk are removed from their sequence and all opponents' sequences. Chunks are removed left-to-right with the remainder of the sequence collapsing down to fill the gap; this operation is repeated until no more chunks are removed, hence multiple removals are possible per turn. During the first round of play, the first player may remove at most one chunk from any opponent, the second player may remove at least two chunks from any opponent, and so on. Players whose sequence length falls below the chunk size are removed from the game; the last surviving player wins. If the sequence length of all players falls below the chunk size then the game is won by the player with the longest sequence, else the game is a tie in the case of equal sequence length. ExampleFor example, the following figure shows a game between ned, ted and jed: ned (36): TCGCATGTACAAAGTTTTCAATCTTCGCCTTGAGAG As first move, ned might nominate the chunk AAG which occurs once in their sequence as well ted's, giving the following result once these chunks have been removed (ned could not have nominated TTG on the first move as that chunk occurs twice in jed's sequence): ned (33): TCGCATGTACATTTTCAATCTTCGCCTTGAGAG As second move, ted might nominate TTC whose removal gives the following result: ned (27): TCGCATGTACATTAATCGCCTTGAGAG NotesChunk removal may be nested and not necessarily straightforward. For example, the chunk AGC only occurs once in the sequence TAAGAAGCGCCT but consider what happens as it is removed: TAAGAAGCGCCT --> TAAGAGCCT --> TAAGCT --> TAT Chunks may be selected strategically to break dangerous formations in your own sequence or to manipulate opponents' sequences to encourage them to attack other opponents. For example, player A might nominate a sequence whose removal causes player B's sequence to form a chunk that's disastrous for player C. There is hence a balance in multiplayer games between hurting your opponents (especially the next player in turn, who you have the greatest control over) and helping them hurt others. Spread the hurt around! Only one strand of each player's double helix is shown as that strand's sequence implies the sequence on the other strand (unless you have eleven toes). Test OptionsThe -min_chunk parameter specifies the minimum chunk size (must be at least 2). SyntaxRemove chunk GGT: Manually set sequence to GCCAATTATGGACTTGTTGTCAGATAGTTTCCGGCG: Alternatively, simply spit on your keyboard to trigger the auto-gene sequencer and start the game with your own unique DNA sequence!* *Not implemented yet. HistoryDNA rules by Cameron Browne, copyright (c) Cyberite Ltd 2008. Graphical web interface: http://www.gamerz.net/pbmserv/List.php?Dna Implementation and Help file by Cameron Browne, October 2008. |